Wednesday, December 30, 2015

187. Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.
Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.
For example,
Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].
Java Code:

No comments:

Post a Comment